Skip to main content
Advertisement

Main menu

  • Home
  • Articles
    • Accepted manuscripts
    • Issue in progress
    • Latest complete issue
    • Issue archive
    • Archive by article type
    • Interviews
    • Sign up for alerts
  • About us
    • About BiO
    • Editors and Board
    • Editor biographies
    • Grants and funding
    • Journal Meetings
    • Workshops
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Sign up for alerts
  • Contact
    • Contact BiO
    • Advertising
    • Feedback
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

User menu

  • Log in

Search

  • Advanced search
Biology Open
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

supporting biologistsinspiring biology

Biology Open

Advanced search

RSS   Twitter   Facebook   YouTube

  • Home
  • Articles
    • Accepted manuscripts
    • Issue in progress
    • Latest complete issue
    • Issue archive
    • Archive by article type
    • Interviews
    • Sign up for alerts
  • About us
    • About BiO
    • Editors and Board
    • Editor biographies
    • Grants and funding
    • Journal Meetings
    • Workshops
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Sign up for alerts
  • Contact
    • Contact BiO
    • Advertising
    • Feedback
Research Article
Spermatogenesis arrest caused by conditional deletion of Hsp90α in adult mice
Chiaki Kajiwara, Shiho Kondo, Shizuha Uda, Lei Dai, Tomoko Ichiyanagi, Tomoki Chiba, Satoshi Ishido, Takehiko Koji, Heiichiro Udono
Biology Open 2012 1: 977-982; doi: 10.1242/bio.2012646
Chiaki Kajiwara
1Laboratories for Immunochaperones, Research Center for Allergy and Immunology (RCAI), RIKEN Yokohama Institute, Yokohama 230-0045, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Shiho Kondo
2Department of Histology and Cell Biology, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Shizuha Uda
1Laboratories for Immunochaperones, Research Center for Allergy and Immunology (RCAI), RIKEN Yokohama Institute, Yokohama 230-0045, Japan
3University of Tsukuba Graduate School of Life and Environmental Sciences, Tsukuba, Ibaraki 305-8577, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Lei Dai
2Department of Histology and Cell Biology, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tomoko Ichiyanagi
4Division of Epigenomics, Medical Institute of Bioregulation, Kyushu University, Fukuoka 812-8582, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Tomoki Chiba
3University of Tsukuba Graduate School of Life and Environmental Sciences, Tsukuba, Ibaraki 305-8577, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Satoshi Ishido
5Infectious Immunity, Research Center for Allergy and Immunology (RCAI), RIKEN Yokohama Institute, Yokohama 230-0045, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Takehiko Koji
2Department of Histology and Cell Biology, Nagasaki University Graduate School of Biomedical Sciences, Nagasaki 852-8523, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: udono@cc.okayama-u.ac.jp tkoji@nagasaki-u.ac.jp
Heiichiro Udono
1Laboratories for Immunochaperones, Research Center for Allergy and Immunology (RCAI), RIKEN Yokohama Institute, Yokohama 230-0045, Japan
6Department of Immunology, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences, Okayama 700-8558, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: udono@cc.okayama-u.ac.jp tkoji@nagasaki-u.ac.jp
  • Article
  • Figures & tables
  • Info & metrics
  • eLetters
  • PDF
Loading

Summary

It is controversial whether a functional androgen receptor (AR) on germ cells, including spermatogonia, is essential for their development into sperm and, thus, initiation and maintenance of spermatogenesis. It was recently shown that many spermatocytes underwent apoptosis in the testes of Hsp90α KO mice. We had generated Hsp90α KO mice independently and confirmed this phenotype. However, the important question of whether Hsp90α is required to maintain spermatogenesis in adult mice in which testicular maturation is already completed could not be addressed using these conventional KO mice. To answer this question, we generated a tamoxifen-inducible deletion mutant of Hsp90α and found that conditional deletion of Hsp90α in adult mice caused even more severe apoptosis in germ cells beyond the pachytene stage, leading to complete arrest of spermatogenesis and testicular atrophy. Importantly, immunohistochemical analysis revealed that AR expression in WT testis was more evident in spermatogonia than in spermatocytes, whereas its expression was aberrant and ectopic in Hsp90α KO testis, raising the possibility that an AR abnormality in primordial germ cells is involved in spermatogenesis arrest in the Hsp90α KO mice. Our results suggest that the AR, specifically chaperoned by Hsp90α in spermatogonia, is critical for maintenance of established spermatogenesis and for survival of spermatocytes in adult testis, in addition to setting the first wave of spermatogenesis before puberty.

Introduction

Androgens are essential steroid hormones in initiation and maintenance of spermatogenesis as well as in the development of secondary male sex maturation. Nevertheless, it is still controversial whether the androgen receptor (AR) of germ cells is indispensable for spermatogenesis (Lyon et al., 1975; Johnston et al., 2001). Studies using germ cell-specific AR deficient mice showed almost normal spermatogenesis as well as fertility (Tsai et al., 2006). The AR gene in these mice is completely deleted in all germ cells beyond the pachytene stage; however, it remains unknown whether it is deleted in spermatogonia (Tsai et al., 2006; Wang et al., 2009).

Heat shock protein (Hsp) 90 is one of the most highly expressed cytosolic molecular chaperones, comprising 1% of the total cellular protein even in non-stressed conditions. It interacts with several hundred client proteins, simultaneously recruiting its own battery of co-chaperones, to facilitate their correct folding, transport, and degradation, thus maintaining normal cellular functions in ATP-dependent manner (Taipale et al., 2010; Echeverria and Picard, 2010). There are two distinct isoforms of Hsp90, Hsp90α and Hsp90β, whose homology is nearly 86% at the amino acid level. Both isoforms are thought to function in various tissues in a mostly redundant manner.

We previously generated Hsp90α-null mice to investigate the role of Hsp90α in antigen-cross presentation. During these studies we became aware that Hsp90α male mice were infertile and found that this resulted from the lack of sperm formation (Ichiyanagi et al., 2010; Imai et al., 2011). But before that, Grad et al. reported that Hsp90α gene trap mutant mice, in which Hsp90α is deleted throughout the entire life of the mouse, developed testicular atrophy caused by apoptosis of spermatocytes (Grad et al., 2010). In this report, there was a further intriguing observation that in one of the two distinct mutant lines the expression of Hsp90α was greatly reduced initially but resumed around day 45. Nonetheless, the mice still remained infertile (Grad et al., 2010). These results strongly imply a critical role of Hsp90α in establishing the first wave of spermatogenesis before puberty, and this in turn led us to the question of whether Hsp90α is required for the maintenance of normal spermatogenesis after testicular maturation is completed.

Based on the outcome of the study of Grad et al., we designed our mutant mice to be tamoxifen-inducible via the loxP-cre system, thus allowing Hsp90α-deletion in adult mice. We observed severe apoptosis occurring in germ cells beyond the pachytene stage, results that led us to conclude that Hsp90α is indispensable for the maintenance of germ cell development even in the mature adult testis. Moreover, we found that expression of AR is absent or reduced in spermatogonia of Hsp90α KO testes, whereas it is strongly expressed in WT testes. Our results indicate that the AR of spermatogonia, which is specifically chaperoned by Hsp90α, is critical for the initiation and maintenance of spermatogenesis.

Results and Discussion

Production of Hsp90αKO and conditional KO mice

The EIIa-cre mouse carries a cre transgene under the control of the adenovirus EIIa promoter that targets expression of Cre recombinase to the early mouse embryo (JAX Mice Database – 003724 B6.FVB-Tg(EIIa-cre)C5379Lmgd/J). Breeding the mice to loxP-flanked Hsp90α mice (Hsp90aa 1neo) (Fig. 1A) produced mice of three genotypes – Hsp90aa Exon 9,10-floxed mice (Hsp90aa 1flox), mice with a deletion of neo and Exons 9 and10 on chromosome (Hsp90aa 1−) (Fig. 1A) and neo-floxed mice (not shown). Complete Hsp90αKO (Hsp90aa 1−/−) mice were obtained by interbreeding the Hsp90aa 1−/+ mice (Imai et al., 2011). We obtained a total of 375 F1 mice and the genotypic ratio of the offspring was Hsp90aa 1+/+:Hsp90aa 1−/+: Hsp90aa 1−/− = 113:194:68. The number of homozygous Hsp90aa 1−/− offspring was significantly lower than the expected Mendelian ratios, suggesting that Hsp90aa 1−/− embryos survive by chance, not in every case, possibly through compensatory contribution of the other isotype of Hsp90, Hsp90β.

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1. Strategy for production of Hsp90α KO mice.

(A) Generation of Hsp90α floxed mice and Hsp90α KO mice. Homologous recombination of the targeting construct into the Hsp90aa1 gene resulted in production of Hsp90αneo mice. By mating with EIIa-Cre mice, Hsp90αflox and Hsp90αEx9−10− mice were obtained. The primers (red boxes) used for PCR detection of the recombination status were on exon 8 and 11, respectively. (B) Generation of Hsp90α conditional KO mice. Hsp90αflox/flox/CreERT2 and Hsp90αflox/+/CreERT2 were generated by the indicated breeding procedures. Administration of tamoxifen resulted in production of Hsp90α−/− and Hsp90α−/+ mice, respectively. (C) Hsp90α KO adult mice (8 weeks) underwent progressive testicular atrophy. (D) H&E staining and a TUNEL assay of the testes of day 17 and 8-week-old WT and Hsp90α KO mice. Scale bars = 100 µm.

By breeding the Hsp90αflox (Hsp90aa 1flox) to B6CreERT2 mice, we obtained inducible mutant mice, thus, Hsp90αflox/flox/CreERT2 and Hsp90αflox/+/CreERT2. CreERT2 mice were generated by knock-in of a fusion gene composed of Cre recombinase and the ERT2 domain of human estrogen receptor gene with three mutations (G400V/M542A/L544A) into the Rosa 26 region (Seibler et al., 2003). Binding of 4-hydroxy tamoxifen to CreERT2 on cell surface causes relocation of the fusion protein to the nucleus, where it deletes floxed genes. Oral administration of tamoxifen (5 mg) to the mice resulted in conditional deletion of exon 9 and 10 of Hsp90aa 1flox, thus producing Hsp90α−/−/CreERT2 and Hsp90α−/+/CreERT2 mice (Fig. 1B).

Testicular atrophy in Hsp90αKO adult mice

Hsp90αKO mice grew normally, nearly comparably to wild type (WT) controls (Fig. 1C). However, we found that male 8-week-old Hsp90αKO mice were infertile and had small scrotums compared to the WT mice. Indeed, their testes were significantly smaller, close to one third the normal size, although the seminal vesicles were not significantly altered (Fig. 1C). Microscopic sperm counts revealed that no spermatozoa could be recovered from the caudal epididymis of 8 to 10 week Hsp90αKO mice. Notably, the size of the prepubescent testes (day 17 after birth) was nearly comparable between Hsp90αKO and WT mice (data not shown).

Decreased spermatogenesis in HSP90αKO mice

To determine which cell type in the testes is affected in Hsp90αKO mice, histological analysis was performed. By H&E staining, there was only a marginal reduction of germ cell development in Hsp90αKO day 17 testes; however, developmental arrest became apparent with progressive age (8 weeks) (Fig. 1D, left panel). TUNEL analysis revealed apoptosis occurring in germ cells after the pachytene stage in day 17 testes and there was increased severity at 8 weeks (Fig. 1D, right panel). The results clearly indicate that reduced numbers of developmental germ cells is caused by apoptosis induction in Hsp90αKO testes with increasing age. The summary of statistics for numbers of TUNEL positive cells is shown in Table 1. Overall, our results obtained from the analysis of Hsp90αKO testes are consistent with those of Grad et al., who used Hsp90aa1 mutant mice produced by the gene trap method (Grad et al., 2010).

View this table:
  • View inline
  • View popup
  • Download powerpoint
Table 1. Statistical analysis of TUNEL positive cells. Number of TUNEL positive cells per 100 tubules were counted. The testes were derived from WT and Hsp90αKO mice at age of 17 days and 8 weeks.

Tamoxifen-inducible deletion of the Hsp90α gene in a wide variety of tissues

To determine the effect of conditional deletion of the Hsp90aa1 gene in adult mice, Hsp90α floxed mice were treated with oral tamoxifen. Genomic DNA was extracted from freshly isolated tissues (Fig. 2A) and the region between Exon 8 and Exon 11 of the Hsp90aa1gene was amplified by PCR, as indicated in Fig. 1A. Administration of tamoxifen resulted in deletion of the floxed Exons 9 and 10, which was demonstrated by identification of a 1.2 kb band (Fig. 2B). The Hsp90α+ and Hsp90αflox alleles could be identified as 2.0 kb and 2.1 kb bands, respectively (Fig. 2B). Although Exon 9 and Exon 10 were deleted, levels of Hsp90α were not reduced at day 6 except in liver (Fig. 2C, day 6). Accordingly, both Hsp90αflox/flox/CreERT2 and Hsp90αflox/+/CreERT2 mice had normal sized testes (Fig. 2D, day 6).

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2. Tamoxifen-induced conditional deletion of Hsp90α results in testicular atrophy.

(A) The scheme of oral administration of tamoxifen and removal of the testes for assay. (B) Genome analysis after administration of tamoxifen. There were some non-specific bands in lanes 3 and 4 in each panel. (C) Expression levels of Hsp90α and Hsp90β in the indicated tissues tested at day 6 and day 30 after administration of tamoxifen. Hsp90α but not Hsp90β is largely downregulated at day 30. (D) Testes obtained at day 6 and 30 after treatment with tamoxifen are shown. The testis recovered from f/f but not f/+ mice underwent atrophy at day 30. (E) Weight (g) of the testes recovered from f/f, f/+, and +/+ mice at day 30 are shown as bar graphs. (n = 6 from 3 mice of each genotype; error bars indicate SD).

Inducible deletion of Hsp90α results in testicular atrophy

We next recovered tissues at day 30 after administration of tamoxifen (Fig. 2A). Unlike the case on day 6, Hsp90α was markedly downregulated in all tissues tested (Fig. 2C, day 30). On day 30, testes of Hsp90αflox/flox/CreERT2 but not Hsp90αflox/+/CreERT2 mice showed atrophy, diminishing to a size similar to that of Hsp90α KO testes (Fig. 2D, day 30). Indeed, the weight of the testes in Hsp90αflox/flox/CreERT2 mice were around one-third that of Hsp90αflox/+/CreERT2 and WT mice (Fig. 2E).

Inducible deletion of Hsp90α in adult mice results in complete arrest of spermatogenesis due to severe apoptosis of germ cells beyond the pachytene stage

Histological analysis revealed pronounced, severe apoptosis and deletion of spermatocytes in testes with conditionally deleted Hsp90α, similar to what was observed in the conventional Hsp90α KO mice. No germ cell development, including the pachytene stage, remained (Fig. 3, upper panel). A TUNEL assay demonstrated that germ cells after pachytene stage underwent apoptosis, leading to a complete arrest of spermatogenesis and cell death of meiotic spermatocytes (Fig. 3, lower left panel). By contrast, Leydig and Sertoli cells seem to be not much impaired, rather closely resembling normal cells. Hsp90β does not compensate for Hsp90α during germ cell development in the testes of the conditional knockout mice. Relevant to this point, Hsp90β appears to be mainly expressed in Sertoli cells, whereas Hsp90α is expressed specifically in primordial and mature germ cells (Lee, 1990; Vanmuylder et al., 2002). Therefore, the limited expression of Hsp90β in germ cells might explain why Hsp90β could not rescue germ cell development in Hsp90α KO testes.

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3. Immunohistochemical analysis of testes recovered from tamoxifen-treated f/+ and f/f mice at day 30.

The testes derived from f/f but not f/+ mice showed severe apoptosis of germ cells beyond the pachytene stage and spermatogenesis arrest, as indicated by H&E staining (upper panel) and the TUNEL assay (lower panel). Scale bar = 100 µm.

Aberrant expression of androgen receptor (AR) in Hsp90α-deficient testes

Androgen-AR interaction plays an important role in spermatogenesis since AR functions as testosterone-dependent transcription factor, initiating expression of an array of androgen-responsive genes (Chang et al., 1988a; Chang et al., 1988b; Lubahn et al., 1988; Heinlein and Chang, 2002). Based on the fundamental importance of AR, we wondered whether AR expression was normal in individual cells (germ cells) of the testis in the absence of Hsp90α. We used specific antibodies and performed immunohistochemical analysis for estrogen receptor (ER)α, ERβ and AR of both WT and Hsp90α KO testes (both 8-week-old). On germ cells, we found dominant expression of ERα and AR in spermatogonia and to a lesser extent in spermatocytes of WT testis, whereas the pattern was disrupted and/or even reversed in Hsp90α KO testis (Fig. 4). In order to discriminate between spermatogonia and spermatocytes, we further performed immunohistochemistry in mirror sections of 8 week and day 17 testes with antibodies specific to synaptonemal complex protein 3 (SCP3) that is expressed in spermatocyte but not in spermatogonia. Consistent with the results in Fig. 4, AR was expressed in germ cells containing both spermatocytes (SCP3 positive) and spermatogonia (SCP3 negative) in WT testes, whereas it was positive in spermatocytes but not in spermatogonia in Hsp90α KO testis (Fig. 5A). In prepuberal testes, on the other hand, AR was positive in only spermatocytes in both WT and Hsp90α KO testes (Fig. 5B). Thus, AR is weakly or not expressed in spermatogonia even in WT testis before puberty, suggesting that AR in spermatoginia is critical in initiation of germ cell development. In other words, most seminiferous tubules showed strong expression of AR (and/or ERβ) in spermatocytes, but little or none in spermatogonia in Hsp90α KO mice, implying that Hsp90α KO testis lacks the androgen-AR signaling in spermatogonia required for subsequent germ cell development.

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4. Aberrant AR expression in Hsp90α KO testes.

H&E staining of WT and knockout testes (Top row). Expression of ERα, (2nd row), ERβ (3rd row) and AR (4th row) in testes derived from WT and Hsp90α KO mice (8 weeks) was tested with specific antibodies. ERβ and AR mostly stained spermatogonia of WT testis. On the other hand, spermatogonia of Hsp90α KO testis were mostly negative and many spermatocytes stained positive, in marked contrast to the pattern in WT testes. Scale bars = 100 µm.

Fig. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 5. SCP3 and AR staining in mirror sections of testes.

Expression of SCP3 and AR in testes derived from WT and Hsp90α KO mice ((A) 8 weeks after birth, (B) 17 days after birth) was tested with specific antibodies. SCP3 stained spermatocytes with meiosis, not spermatogonia, not Sertoli cells. AR stained spermatogonia and spermatocytes of 8 weeks WT testis (A). On the other hand, spermatogonia of Hsp90α KO testis were mostly negative and many spermatocytes stained positive, in marked contrast to the pattern in WT testes (A). AR stained only spermatocytes in both WT and Hsp90α KO testis (17 days) (B). The marked cells are indicated as representative spermatogonia (solid lines), spermatocyte (dashed lines), and Sertoli cells (dotted lines). Scale bars = 50 µm, except top row of A where scale bar = 100 µm.

AR is chaperoned by Hsp90 before its association with testosterone and Hsp90 inhibitors caused AR-Hsp90 complex to dissociate, which might cause degradation of AR by the proteasome (Whitesell and Cook, 1996; Zhang et al., 2006). Although the precise reason why AR is missing in spermatogonia of the Hsp90α KO testis is unknown, it is plausible that AR undergoes degradation following deletion of Hsp90α gene since it is usually chaperoned by Hsp90α and not by Hsp90β. Although absent in spermatogonia, AR seemed to reappear in germ cells of Hsp90α KO testis. This might be because the proteasome activity in germ cells (beyond the pachytene stage) already undergoing apoptosis is downregulated, which eventually causes accumulation of AR within the cells. The balance between Hsp90α-mediated chaperone activity and proteasomal activity determines the expression level of AR in germ cells. Hsp90α deficiency might influence this balance, giving rise to the observed aberrant expression pattern of AR in germ cells including spermatogonia. It is also possible that Hsp90α simply regulates (facilitates) transcriptional activation of AR gene in spermatogonia.

Germ cell-specific AR KO mice did not show testicular atrophy, nor did they show spermatogenesis arrest, indicating that the androgen-AR interaction in germ cells is dispensable for their development (Tsai et al., 2006). These observations conflict with our hypothesis that Hsp90α-dependent AR expression in spermatogonia is essential in subsequent germ cell development. However, the germ cell-specific AR KO mice were generated by mating the floxed AR mice with synaptonemal complex protein 1 promoter (Sycp1-cre) transgenic mice (Tsai et al., 2006). Sycp1 is expressed at an early stage of male meiosis, leptene to zygotene, therefore, the floxed AR allele might not be deleted in spermatogonia of these mice.

Sertoli cell- and Leydig cell-specific AR KO mice have a testicular phenotype very similar to the Hsp90α KO, i.e., no sperm formation, disrupted germ cell development and testicular atrophy (Chang et al., 2004; De Gendt et al., 2004; Holdcraft and Braun, 2004; Xu et al., 2007). However, in our Hsp90α KO mice, both Sertoli cells and Leydig cells appeared normal. It is possible that the AR-mediated transcriptional cascade in Sertoli- and Leydig-cells of our mice is not impaired due to the compensatory effect of Hsp90β, since this isotype rather than Hsp90α is mainly expressed in these cell types (Lee, 1990; Vanmuylder et al., 2002).

In summary, we have established Hsp90α conditional deletion mutant mice and found that spermatogenesis in adult testes was completely abrogated through apoptosis caused by inducible ablation of the Hsp90α gene. In addition, AR expression in spermatogonia was downregulated in Hsp90αKO testis. Although our results raised the possibility that AR-dependent signaling is essential in the subsequent germ cell development, further studies will be required to test this hypothesis.

Materials and Methods

Generation of Hsp90α conditional KO mice

Conditional HSP90α-null mice were generated by deleting exons 9 and 10, which encode the C-terminal region of the protein, in a cre-recombinase-dependent manner (Imai et al., 2011). Tamoxifen-dependent, inducible deletion of the floxed exons was performed according to a previous report (Hikida et al., 2009). Briefly, mice were orally administrated 100 µl 4-hydroxy tamoxifen (Sigma T5648) dissolved in corn oil (Sigma C8267) at a dose of 50 mg/kg, twice in a two-day interval. Mice were analyzed 4 d and 28 d after the last injection. Deletion efficiency of exons 9 and 10 was assessed by genomic PCR. The samples were subjected to Western blotting analysis using antibodies specific for Hsp90α (mouse mAb EMD-17D7, Calbiochem.), Hsp90β (rabbit polyclonal Abs, Lab Vision Corporation, Fremont, CA) and actin (Sigma).

Genomic-PCR

The primers used for genotyping of mice after oral administration of tamoxifen were forward (within exon 8): ttctctgaaggactactgtaccagaatgaa, and reverse (downstream of exon 11): gtgtgggggtgcgcaaagaaaagacacatt. The primers for detection of the cre-recombinase gene were forward: caccctgttacgtatagcc, and reverse: ctctgaccagagtcatcct.

Immunohistochemistry

Enzyme immunohistochemistry was performed on paraffin sections (5–6 µm) of the mouse testis, as described previously (Koji et al., 2001; Song et al., 2011). The antibody dilutions were as follows: rabbit anti-AR antiserum (Millipore AB561) was at 1:800, mouse monoclonal anti-ERα (BioGenex ER88) was at 1:100, mouse monoclonal anti-ERβ (BioGenex ERβ88) was at 1:200, and rabbit anti-SCP3 antibody (Novus Biologicals NB300-231) was at 1:750 (1.33 µg/ml). After the reaction with horseradish peroxidase (HRP)-conjugated second antibody, the sites of HRP deposition were visualized with 3,3′-diaminobenzidine-4HCl (DAB) and H2O2 in the presence or absence of nickel and cobalt ions (Shukuwa et al., 2006). In every experimental run, negative control samples were prepared by reacting the sections with normal rabbit serum (for AR) or normal mouse IgG (ERα and ERβ) instead of the specific first antibody. To identify apoptotic cells, Terminal deoxynucleotidyl transferase (TdT)-ated dUTP nick end-labeling (TUNEL) staining was performed according to the method (Gavrieli et al., 1992) with a slight modification (Koji et al., 2001).

Footnotes

  • Competing interests The authors have no competing interests to declare.

  • Received January 4, 2012.
  • Accepted July 11, 2012.
  • © 2012. Published by The Company of Biologists Ltd

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial Share Alike License (http://creativecommons.org/licenses/by-nc-sa/3.0/).

References

  1. ↵
    1. Chang C. S.,
    2. Kokontis J.,
    3. Liao S. T.
    (1988a). Molecular cloning of human and rat complementary DNA encoding androgen receptors. Science 240, 324–326. doi:10.1126/science.3353726
    OpenUrlAbstract/FREE Full Text
  2. ↵
    1. Chang C. S.,
    2. Kokontis J.,
    3. Liao S. T.
    (1988b). Structural analysis of complementary DNA and amino acid sequences of human and rat androgen receptors. Proc. Natl. Acad. Sci. USA 85, 7211–7215. doi:10.1073/pnas.85.19.7211
    OpenUrlAbstract/FREE Full Text
  3. ↵
    1. Chang C.,
    2. Chen Y. T.,
    3. Yeh S. D.,
    4. Xu Q.,
    5. Wang R. S.,
    6. Guillou F.,
    7. Lardy H.,
    8. Yeh S.
    (2004). Infertility with defective spermatogenesis and hypotestosteronemia in male mice lacking the androgen receptor in Sertoli cells. Proc. Natl. Acad. Sci. USA 101, 6876–6881. doi:10.1073/pnas.0307306101
    OpenUrlAbstract/FREE Full Text
  4. ↵
    1. De Gendt K.,
    2. Swinnen J. V.,
    3. Saunders P. T.,
    4. Schoonjans L.,
    5. Dewerchin M.,
    6. Devos A.,
    7. Tan K.,
    8. Atanassova N.,
    9. Claessens F.,
    10. Lécureuil C.
    et al. (2004). A Sertoli cell-selective knockout of the androgen receptor causes spermatogenic arrest in meiosis. Proc. Natl. Acad. Sci. USA 101, 1327–1332. doi:10.1073/pnas.0308114100
    OpenUrlAbstract/FREE Full Text
  5. ↵
    1. Echeverria P. C.,
    2. Picard D.
    (2010). Molecular chaperones, essential partners of steroid hormone receptors for activity and mobility. Biochim. Biophys. Acta 1803, 641–649. doi:10.1016/j.bbamcr.2009.11.012
    OpenUrlCrossRefPubMedWeb of Science
  6. ↵
    1. Gavrieli Y.,
    2. Sherman Y.,
    3. Ben-Sasson S. A.
    (1992). Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol. 119, 493–501. doi:10.1083/jcb.119.3.493
    OpenUrlAbstract/FREE Full Text
  7. ↵
    1. Grad I.,
    2. Cederroth C. R.,
    3. Walicki J.,
    4. Grey C.,
    5. Barluenga S.,
    6. Winssinger N.,
    7. De Massy B.,
    8. Nef S.,
    9. Picard D.
    (2010). The molecular chaperone Hsp90α is required for meiotic progression of spermatocytes beyond pachytene in the mouse. PLoS ONE 5, e15770. doi:10.1371/journal.pone.0015770
    OpenUrlCrossRefPubMed
  8. ↵
    1. Heinlein C. A.,
    2. Chang C.
    (2002). Androgen receptor (AR) coregulators: an overview. Endocr. Rev. 23, 175–200. doi:10.1210/er.23.2.175
    OpenUrlCrossRefPubMedWeb of Science
  9. ↵
    1. Hikida M.,
    2. Casola S.,
    3. Takahashi N.,
    4. Kaji T.,
    5. Takemori T.,
    6. Rajewsky K.,
    7. Kurosaki T.
    (2009). PLC-γ2 is essential for formation and maintenance of memory B cells. J. Exp. Med. 206, 681–689. doi:10.1084/jem.20082100
    OpenUrlAbstract/FREE Full Text
  10. ↵
    1. Holdcraft R. W.,
    2. Braun R. E.
    (2004). Androgen receptor function is required in Sertoli cells for the terminal differentiation of haploid spermatids. Development 131, 459–467. doi:10.1242/dev.00957
    OpenUrlAbstract/FREE Full Text
  11. ↵
    1. Ichiyanagi T.,
    2. Imai T.,
    3. Kajiwara C.,
    4. Mizukami S.,
    5. Nakai A.,
    6. Nakayama T.,
    7. Udono H.
    (2010). Essential role of endogenous heat shock protein 90 of dendritic cells in antigen cross-presentation. J. Immunol. 185, 2693–2700. doi:10.4049/jimmunol.1000821
    OpenUrlAbstract/FREE Full Text
  12. ↵
    1. Imai T.,
    2. Kato Y.,
    3. Kajiwara C.,
    4. Mizukami S.,
    5. Ishige I.,
    6. Ichiyanagi T.,
    7. Hikida M.,
    8. Wang J. Y.,
    9. Udono H.
    (2011). Heat shock protein 90 (HSP90) contributes to cytosolic translocation of extracellular antigen for cross-presentation by dendritic cells. Proc. Natl. Acad. Sci. USA 108, 16363–16368. doi:10.1073/pnas.1108372108
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Johnston D. S.,
    2. Russell L. D.,
    3. Friel P. J.,
    4. Griswold M. D.
    (2001). Murine germ cells do not require functional androgen receptors to complete spermatogenesis following spermatogonial stem cell transplantation. Endocrinology 142, 2405–2408. doi:10.1210/en.142.6.2405
    OpenUrlCrossRefPubMedWeb of Science
  14. ↵
    1. Koji T.,
    2. Hishikawa Y.,
    3. Ando H.,
    4. Nakanishi Y.,
    5. Kobayashi N.
    (2001). Expression of Fas and Fas ligand in normal and ischemia-reperfusion testes: involvement of the Fas system in the induction of germ cell apoptosis in the damaged mouse testis. Biol. Reprod. 64, 946–954. doi:10.1095/biolreprod64.3.946
    OpenUrlAbstract/FREE Full Text
  15. ↵
    1. Lee S. J.
    (1990). Expression of HSP86 in male germ cells. Mol. Cell. Biol. 10, 3239–3242. doi:10.1128/MCB.10.6.3239
    OpenUrlAbstract/FREE Full Text
  16. ↵
    1. Lubahn D. B.,
    2. Joseph D. R.,
    3. Sullivan P. M.,
    4. Willard H. F.,
    5. French F. S.,
    6. Wilson E. M.
    (1988). Cloning of human androgen receptor complementary DNA and localization to the X chromosome. Science 240, 327–330. doi:10.1126/science.3353727
    OpenUrlAbstract/FREE Full Text
  17. ↵
    1. Lyon M. F.,
    2. Glenister P. H.,
    3. Lamoreux M. L.
    (1975). Normal spermatozoa from androgen-resistant germ cells of chimaeric mice and the role of androgen in spermatogenesis. Nature 258, 620–622. doi:10.1038/258620a0
    OpenUrlCrossRefPubMed
  18. ↵
    1. Seibler J.,
    2. Zevnik B.,
    3. Küter-Luks B.,
    4. Andreas S.,
    5. Kern H.,
    6. Hennek T.,
    7. Rode A.,
    8. Heimann C.,
    9. Faust N.,
    10. Kauselmann G.
    et al. (2003). Rapid generation of inducible mouse mutants. Nucleic Acids Res. 31, e12. doi:10.1093/nar/gng012
    OpenUrlAbstract/FREE Full Text
  19. ↵
    1. Shukuwa K.,
    2. Izumi S.,
    3. Hishikawa Y.,
    4. Ejima K.,
    5. Inoue S.,
    6. Muramatsu M.,
    7. Ouchi Y.,
    8. Kitaoka T.,
    9. Koji T.
    (2006). Diethylstilbestrol increases the density of prolactin cells in male mouse pituitary by inducing proliferation of prolactin cells and transdifferentiation of gonadotropic cells. Histochem. Cell Biol. 126, 111–123. doi:10.1007/s00418-005-0141-6
    OpenUrlCrossRefPubMed
  20. ↵
    1. Song N.,
    2. Liu J.,
    3. An S.,
    4. Nishino T.,
    5. Hishikawa Y.,
    6. Koji T.
    (2011). Immunohistochemical analysis of histone H3 modifications in germ cells during mouse spermatogenesis. Acta Histochem. Cytochem. 44, 183–190. doi:10.1267/ahc.11027
    OpenUrlCrossRefPubMed
  21. ↵
    1. Taipale M.,
    2. Jarosz D. F.,
    3. Lindquist S.
    (2010). HSP90 at the hub of protein homeostasis: emerging mechanistic insights. Nat. Rev. Mol. Cell Biol. 11, 515–528. doi:10.1038/nrm2918
    OpenUrlCrossRefPubMedWeb of Science
  22. ↵
    1. Tsai M. Y.,
    2. Yeh S. D.,
    3. Wang R. S.,
    4. Yeh S.,
    5. Zhang C.,
    6. Lin H. Y.,
    7. Tzeng C. R.,
    8. Chang C.
    (2006). Differential effects of spermatogenesis and fertility in mice lacking androgen receptor in individual testis cells. Proc. Natl. Acad. Sci. USA 103, 18975–18980. doi:10.1073/pnas.0608565103
    OpenUrlAbstract/FREE Full Text
  23. ↵
    1. Vanmuylder N.,
    2. Werry-Huet A.,
    3. Rooze M.,
    4. Louryan S.
    (2002). Heat shock protein HSP86 expression during mouse embryo development, especially in the germ-line. Anat. Embryol. (Berl.) 205, 301–306. doi:10.1007/s00429-002-0258-5
    OpenUrlCrossRefPubMed
  24. ↵
    1. Wang R. S.,
    2. Yeh S.,
    3. Tzeng C. R.,
    4. Chang C.
    (2009). Androgen receptor roles in spermatogenesis and fertility: lessons from testicular cell-specific androgen receptor knockout mice. Endocr. Rev. 30, 119–132. doi:10.1210/er.2008-0025
    OpenUrlCrossRefPubMedWeb of Science
  25. ↵
    1. Whitesell L.,
    2. Cook P.
    (1996). Stable and specific binding of heat shock protein 90 by geldanamycin disrupts glucocorticoid receptor function in intact cells. Mol. Endocrinol. 10, 705–712. doi:10.1210/me.10.6.705
    OpenUrlCrossRefPubMedWeb of Science
  26. ↵
    1. Xu Q.,
    2. Lin H. Y.,
    3. Yeh S. D.,
    4. Yu I. C.,
    5. Wang R. S.,
    6. Chen Y. T.,
    7. Zhang C.,
    8. Altuwaijri S.,
    9. Chen L. M.,
    10. Chuang K. H.
    et al. (2007). Infertility with defective spermatogenesis and steroidogenesis in male mice lacking androgen receptor in Leydig cells. Endocrine 32, 96–106. doi:10.1007/s12020-007-9015-0
    OpenUrlCrossRefPubMedWeb of Science
  27. ↵
    1. Zhang X.,
    2. Clark A. F.,
    3. Yorio T.
    (2006). Heat shock protein 90 is an essential molecular chaperone for nuclear transport of glucocorticoid receptor β. Invest. Ophthalmol. Vis. Sci. 47, 700–708. doi:10.1167/iovs.05-0697
    OpenUrlAbstract/FREE Full Text
Previous ArticleNext Article
Back to top
Previous ArticleNext Article

This Issue

RSSRSS

Keywords

  • Hsp90α
  • Spermatogonia
  • Spermatogenesis
  • Androgen receptor

 Download PDF

Email

Thank you for your interest in spreading the word on Biology Open.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Spermatogenesis arrest caused by conditional deletion of Hsp90α in adult mice
(Your Name) has sent you a message from Biology Open
(Your Name) thought you would like to see the Biology Open web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Research Article
Spermatogenesis arrest caused by conditional deletion of Hsp90α in adult mice
Chiaki Kajiwara, Shiho Kondo, Shizuha Uda, Lei Dai, Tomoko Ichiyanagi, Tomoki Chiba, Satoshi Ishido, Takehiko Koji, Heiichiro Udono
Biology Open 2012 1: 977-982; doi: 10.1242/bio.2012646
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools
Research Article
Spermatogenesis arrest caused by conditional deletion of Hsp90α in adult mice
Chiaki Kajiwara, Shiho Kondo, Shizuha Uda, Lei Dai, Tomoko Ichiyanagi, Tomoki Chiba, Satoshi Ishido, Takehiko Koji, Heiichiro Udono
Biology Open 2012 1: 977-982; doi: 10.1242/bio.2012646

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Alerts

Please log in to add an alert for this article.

Sign in to email alerts with your email address

Article Navigation

  • Top
  • Article
    • Summary
    • Introduction
    • Results and Discussion
    • Materials and Methods
    • Footnotes
    • References
  • Figures & tables
  • Info & metrics
  • eLetters
  • PDF

Related articles

Cited by...

More in this TOC section

  • Local adaptation in thermal tolerance for a tropical butterfly across ecotone and rainforest habitats
  • Validating accelerometry-derived proxies of energy expenditure using the doubly labelled water method in the smallest penguin species
  • Three functional polymorphisms in CCDC170 were associated with osteoporosis phenotype
Show more RESEARCH ARTICLE

Similar articles

Other journals from The Company of Biologists

Development

Journal of Cell Science

Journal of Experimental Biology

Disease Models & Mechanisms

Advertisement

Biology Open and COVID-19

We are aware that the COVID-19 pandemic is having an unprecedented impact on researchers worldwide. The Editors of all The Company of Biologists’ journals have been considering ways in which we can alleviate concerns that members of our community may have around publishing activities during this time. Read about the actions we are taking at this time.

Please don’t hesitate to contact the Editorial Office if you have any questions or concerns.


Future Leader Review - Cardiac myosin super relaxation

A new Future Leader Review by Manuel Schmid and Christopher Toepfer discusses the rapidly-expanding field of myosin super relaxation in the context of cardiovascular disease. Read the full Review and their accompanying interview.

Find out more about our Future Leader Reviews – they are an exclusive opportunity for early-career researchers who want to establish themselves in their field.


An interview with Roberta Azzarelli

In an interview, first author Roberta Azzarelli discusses her 3D model of glioblastoma and shares her thoughts on how to improve the professional lives of early-career researchers: formal mentorship programmes, a clearly structured career path and taking part in initiatives such as the Node Network.


News from our sister journals

Development continues to run a successful new webinar series, Development presents…, while Journal of Cell Science has recently welcomed Esperanza Agullo-Pascual as FocalPlane’s new Community Manager. Journal of Experimental Biology’s new special issue highlights the role of comparative biology in tackling climate change and Liz Patton, the new Editor-in-Chief of Disease Models & Mechanisms, sets out her visions and priorities.

Articles

  • Accepted manuscripts
  • Issue in progress
  • Latest complete issue
  • Issue archive
  • Archive by article type
  • Interviews
  • Sign up for alerts

About us

  • About BiO
  • Editors and Board
  • Editor biographies
  • Grants and funding
  • Journal Meetings
  • Workshops
  • The Company of Biologists

For Authors

  • Submit a manuscript
  • Aims and scope
  • Presubmission enquiries
  • Article types
  • Manuscript preparation
  • Cover suggestions
  • Editorial process
  • Promoting your paper
  • Open Access

Journal Info

  • Journal policies
  • Rights and permissions
  • Media policies
  • Reviewer guide
  • Sign up for alerts

Contact

  • Contact BiO
  • Advertising
  • Feedback

Twitter   YouTube   LinkedIn

© 2021   The Company of Biologists Ltd   Registered Charity 277992