Skip to main content
Advertisement

Main menu

  • Home
  • Articles
    • Accepted manuscripts
    • Issue in progress
    • Latest complete issue
    • Issue archive
    • Archive by article type
    • Interviews
    • Sign up for alerts
  • About us
    • About BiO
    • Editors and Board
    • Editor biographies
    • Grants and funding
    • Journal Meetings
    • Workshops
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Sign up for alerts
  • Contact
    • Contact BiO
    • Advertising
    • Feedback
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

User menu

  • Log in

Search

  • Advanced search
Biology Open
  • COB
    • About The Company of Biologists
    • Development
    • Journal of Cell Science
    • Journal of Experimental Biology
    • Disease Models & Mechanisms
    • Biology Open

supporting biologistsinspiring biology

Biology Open

Advanced search

RSS   Twitter   Facebook   YouTube

  • Home
  • Articles
    • Accepted manuscripts
    • Issue in progress
    • Latest complete issue
    • Issue archive
    • Archive by article type
    • Interviews
    • Sign up for alerts
  • About us
    • About BiO
    • Editors and Board
    • Editor biographies
    • Grants and funding
    • Journal Meetings
    • Workshops
    • The Company of Biologists
    • Journal news
  • For authors
    • Submit a manuscript
    • Aims and scope
    • Presubmission enquiries
    • Article types
    • Manuscript preparation
    • Cover suggestions
    • Editorial process
    • Promoting your paper
    • Open Access
  • Journal info
    • Journal policies
    • Rights and permissions
    • Media policies
    • Reviewer guide
    • Sign up for alerts
  • Contact
    • Contact BiO
    • Advertising
    • Feedback
Research Article
Mindbomb 2 is dispensable for embryonic development and Notch signalling in zebrafish
Shohei Mikami, Mizuki Nakaura, Atsuo Kawahara, Takamasa Mizoguchi, Motoyuki Itoh
Biology Open 2015 4: 1576-1582; doi: 10.1242/bio.014225
Shohei Mikami
1Graduate School of Pharmaceutical Sciences, Chiba University, Chiba 260-8675, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Mizuki Nakaura
1Graduate School of Pharmaceutical Sciences, Chiba University, Chiba 260-8675, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Atsuo Kawahara
2Laboratory for Developmental Biology, Center for Medical Education and Sciences, Graduate School of Medical Science, University of Yamanashi, Yamanashi 409-3898, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Takamasa Mizoguchi
1Graduate School of Pharmaceutical Sciences, Chiba University, Chiba 260-8675, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
Motoyuki Itoh
1Graduate School of Pharmaceutical Sciences, Chiba University, Chiba 260-8675, Japan
  • Find this author on Google Scholar
  • Find this author on PubMed
  • Search for this author on this site
  • For correspondence: mito@chiba-u.jp
  • Article
  • Figures & tables
  • Supp info
  • Info & metrics
  • eLetters
  • PDF + SI
  • PDF
Loading

ABSTRACT

The Mindbomb E3 ubiquitin protein ligase (Mib) family of proteins, Mib1 and Mib2, are RING finger ubiquitin ligases that share specific substrates. Mib1 is known to play essential roles in Notch signalling by ubiquitinating Notch ligands in vivo. Conversely, the functions of Mib2 in vivo are not fully understood, although Mib2 ubiquitinates multiple substrates, including Notch ligands, in vitro. To determine the Notch-dependent and Notch-independent functions of Mib2 in vivo, we generated mutant alleles of zebrafish mib2 using transcription activator-like effector nucleases (TALENs). We found that mib2 homozygous mutants were viable and fertile. Notch-mediated functions, such as early neurogenesis, somitogenesis, and pigment cell development, were not affected in mib2 mutant embryos. The lack of Notch-deficient phenotypes in mib2 mutants was not due to compensation by a mib2 maternal gene product because mib2 maternal-zygotic mutants also did not exhibit a distinct phenotype. We also showed that Mib2 does not redundantly act with Mib1 because the genetic ablation of mib2 neither enhanced mibtfi91-null phenotypes nor did it alleviate antimorphic mibta52b phenotypes. Furthermore, the postulated Notch-independent roles of Mib2 in maintaining muscular integrity and N-methyl-D-aspartate receptor (NMDAR) activity were not evident: mib2 mutants did not show phenotypes different from that of the control embryos. These observations suggest that Mib2 is dispensable for embryonic development and does not have redundant functions with Mib1 in Notch signalling at least during early development stages in zebrafish.

INTRODUCTION

Ubiquitination is a posttranslational modification that regulates protein functions and is associated with diverse cellular functions and human diseases (Komander and Rape, 2012; Popovic et al., 2014). E3 ubiquitin ligases play important roles in facilitating ubiquitin transfer from the ubiquitin-conjugating enzyme E2 to the substrate and determining substrate specificity (Pickart, 2001).

Mib2, which is also known as skeletrophin, is a RING finger ubiquitin ligase that was originally cloned from aggregated neuroblastoma cells and shown to interact with alpha-actin (Takeuchi et al., 2003). The domain organization and sequence of Mib2 are similar to those of Mib1, which plays essential roles in activating Notch signalling in metazoans (Itoh et al., 2003; Koo et al., 2005; Nguyen et al., 2007; Zhang et al., 2007a; Yamamoto et al., 2010). Notch signalling is a well-conserved signalling pathway that is required for several processes during embryonic development, such as the generation of neurons and somites, and adult tissue function (Guruharsha et al., 2012). Previous studies showed that Mib2 ubiquitinates Notch ligands in vitro (Koo et al., 2005; Takeuchi et al., 2005; Zhang et al., 2007a). However, Mib2 may not significantly affect Notch signalling in vivo because mouse or Drosophila Mib2 mutants do not show strong Notch loss-of-function phenotypes. Because maternal gene products deposited into eggs are involved in early embryonic development in metazoan, the lack of a strong phenotype of mib2 mutants may be due to the masking of phenotypes in homozygous mib2 mutants by a Mib2 maternal gene product during development. However, the maternal/zygotic function of Mib2 has not been explored.

Moreover, because Mib2 is homologous to Mib1, redundant functions between Mib1 and Mib2 have been examined using double knockout/knockdown animals. In mice, Mib1/Mib2 double knockout does not cause a more severe phenotype than Mib1 single knockout. In contrast Zhang et al. showed the roles of Mib2 and Mib1 are redundant in zebrafish, as evidenced by the fact that mib2 knockdown enhances the phenotypes of mib1-null mutant embryos. These conflicting reports may indicate species differences in Mib2 functions. Alternatively, the morpholino (MO)-mediated knockdown of Mib2 in zebrafish might cause non-specific effects, as evidenced by a recent report demonstrating that MO-mediated knockdown is associated with a high false-positive rate (Kok et al., 2015). Thus, zebrafish mib2 mutant analysis should help resolve this issue.

RING-type E3 ubiquitin ligases regulate diverse cellular functions, and a RING ubiquitin ligase may have multiple substrates (Metzger et al., 2014). Indeed, previous studies suggested that Mib1/Mib2 family ubiquitin ligases have multiple substrates other than the Notch ligand; thus, Mib2 may also play Notch signalling-independent roles in vivo (Tseng et al., 2014). Accordingly, Mib2 is involved in maintaining muscle integrity in vivo in Drosophila, although the Mib2 substrate responsible for this function is not known (Nguyen et al., 2007; Carrasco-Rando and Ruiz-Gomez, 2008). In contrast, the conservation of this function of Mib2 among different species is not well understood. Conversely, the N-methyl-D-aspartate receptor (NMDAR) NR2B subunit was identified as a substrate for Mib2 in vitro, but the role of Mib2 in regulating NMDAR activity has not been investigated in vivo (Jurd et al., 2008).

Here, we generated zebrafish mib2 mutant lines using Transcription activator-like effector nucleases (TALENs) to better understand the in vivo role of Mib2. An analysis of the mib2 mutants did not reveal obvious contributions of Mib2 to Notch signalling, muscle integrity, and NMDAR activity. Furthermore, redundant roles between Mib1 and Mib2 in Notch signalling were not explicitly evident, at least during early development.

RESULTS

Generation of Mib2 mutant zebrafish

To understand the functions of Mib2 in vivo, we generated three mutant alleles of zebrafish mib2 using transcription activator-like effector nucleases (TALENs), i.e. mib2cd1, mib2cd2 and mib2cd3 (Fig. 1A,B). Two of the mutant alleles, mib2cd1 and mib2cd3, feature 8 bp deletions, whereas mib2cd2 features one bp insertion and 8 bp deletions (Fig. 1). All mutations created stop codons in the first ankyrin repeat domain (Fig. 1A,B) (Mib2cd1, A538stop; Mib2cd2, Q531stop; and Mib2cd3, I536stop). We selected mib2cd1 and mib2cd3 for further analysis because their mutation can be identified by PCR-based restriction fragment length polymorphism typing (Fig. S1). The expression of mib2, as examined by in situ hybridization in these mib2 mutants, showed that the mib2 mRNA level was reduced in heterozygous or homozygous mutant embryos, which was likely due to nonsense mediated decay 48 h post-fertilization (hpf) (Fig. 2A) (mib2cd1/+, 74% with low-level expression, n=31; mib2cd1, 85% with low-level expression, n=13; mib2cd3/+, 70% with low level expression, n=27; mib2cd3, 100%, with low-level expression, n=18). Both the mib2cd1 and mib2cd3 homozygous mutants were viable and grew to sexually mature adulthood. Therefore, the mib2 mRNA level was further examined by quantitative real time PCR (q-PCR) using RNA extracted from mib2cd3 homozygous or mib2cd3 heterozygous embryos, which were obtained by crossing mib2cd3 homozygous males and females or mib2cd3 heterozygous males and homozygous females, respectively. This q-PCR measurement showed lower level of mib2 expression in mib2cd3 heterozygous and homozygous embryos than in wild type control embryos (Fig. 2B) (mib2cd3/+, 52%; mib2cd3, 24%). Therefore, mutations in mib2cd1 and mib2cd3 alleles result in a loss of mib2 function.

Fig. 1.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 1.

Generation of mib2 mutants by TALEN. (A) Schematic representation of the genomic structure of the mib2 gene and mutations produced by TALEN. The TALEN target sequences are boxed. (B) Domain organization of Mib2 protein. All three mutations (cd1, cd2, and cd3) generate premature stop codons.

Fig. 2.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 2.

Expression of mib2 is reduced in mib2 mutant embryos. (A) Whole-mount in situ hybridization using the mib2 antisense probe in embryos at 48 hpf. Arrowheads indicate mib2 expression in the ear. Head region, side views of embryos at 48 hpf with anterior to the left. (B) Relative expression level of mib2 mRNA measured by q-PCR in the 48 hpf-embryos. Error bars represent the mean±s.d. of three independent experiments.

Mib2 is not involved in Notch signalling during early neurogenesis and is not redundant to Mib1

Because Mib2 exhibits sequence homology with Mib1, we investigated the functions of Mib2 alone and in collaboration with Mib1 during early neurogenesis. The expression of an early neuronal cell marker, elavl3, was not dramatically changed in mib2cd3 mutant embryos at the 3 somite stage (Fig. 3A) (100% with normal expression, n=20). In contrast, embryos homozygous for two alleles of mib1, mib1tfi91 and mib1ta52b, showed increased levels of elavl3 expression (Fig. 3A) (mib1tfi91, 88% with high-level expression, n=16; mib1ta52b, 89% with high-level expression, n=9). We next examined the expression of a Notch target gene, her4.1, in the neural cells of mib1 and mib2 mutant embryos at the 3 somite stage (Takke et al., 1999). The expression of her4.1 also remained unchanged in mib2cd3 mutant embryos (Fig. 3B) (mib2cd3, 100% with normal expression, n=21), whereas it was reduced in both mib1 mutant (mib1tfi91 and mib1ta52b) embryos. However, the phenotype was slightly more pronounced in mib1ta52b embryos than in mib1tfi91 embryos (Fig. 3B) (mib1tfi91, 89% with low-level expression, n=9; mib1ta52b, 100% with low-level expression, n=6). Furthermore, the collaborative functions of mib1 and mib2 were examined using mib1/mib2 double mutants. The expression levels of elavl3 (Fig. 3A) (mib1tfi91; mib2cd3, 92% with high-level expression, n=12: mib1ta52b; mib2cd3, 75% with high-level expression, n=8) and her4.1 (Fig. 3B) (mib1tfi91; mib2cd3, 83% with low-level expression, n=12: mib1ta52b; mib2cd3, 100% with low-level expression, n=7) did not significantly differ between the mib1 mutants and mib1/mib2 double mutants. These data suggest that Mib2 does not play a significant role in Notch signalling during early neurogenesis, alone or in combination with Mib1.

Fig. 3.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 3.

Mib2 deficiency does not significantly affect early neurogenesis and Notch signalling. Whole-mount in situ hybridization using elavl3 (A) and her4.1 (B) antisense probes at the 3 somite stage, showing no difference in neurogenesis phenotypes between wild-type and mib2cd3 embryos or between the mib1 mutants and mib1/mib2 double mutants. All panels show top views of embryos with the anterior to the left.

Mib2 does not exert maternal functions during early neurogenesis and somitogenesis and is not redundant to Mib1

Previous studies have shown that the maternal expression of genes can partially compensate for a loss of zygotic gene function (Gritsman et al., 1999; Mintzer et al., 2001). Because mib2 is maternally expressed, we addressed the maternal function of Mib2. Homozygous mib2cd3 embryos survived to fertile adulthood, and maternal-zygotic (MZ) mib2cd3 mutant embryos were obtained by mating homozygous mib2cd3 females with heterozygous mib2cd3 males. In MZ mib2cd3 mutant embryos, her4.1 expression at 24 hpf did not differ from that in heterozygous control embryos (Fig. 4A) (MZ mib2cd3, 100% with normal expression, n=11). We also investigated the maternal function of Mib2 during early somitogeneis, but the pattern of somite segmentation, as revealed by xirp2a expression, was not affected in MZ mib2cd3 mutant embryos at 24 hpf (Fig. 4B) (number of somite boundaries; mib2cd3/+, 19.1±0.5, n=11; MZ mib2cd3, 19.3±1.4, n=11). In contrast, her4.1 expression was reduced in mib1tfi91; mib2cd3/+ embryos (Fig. 4A) (mib1tfi91; mib2cd3/+, 100% with low-level expression, n=10), and the regular spacing of the somites was disrupted (Fig. 4B) (number of boundaries: mib1tfi91; mib2cd3/+, 16.4±2.3, n=16) because these deficits are due to the disruption of Notch function. However, mib1tfi91; MZ mib2cd3 double mutant embryos did not show more severe phenotypes than mib1tfi91; mib2cd3/+ embryos, both in her4.1 expression (Fig. 4A) (her4.1: mib1tfi91; MZmib2cd3, 100% with a similar level to that in mib1tfi91; mib2cd3/+, n=5) and somite numbers (Fig. 4B) (mib1tfi91; MZmib2cd3, 16.1±1.1, n=14). Therefore, maternal mib2 expression does not compensate for the loss of zygotic Mib2 function.

Fig. 4.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 4.

Maternal Mib2 does not compensate for the zygotic loss of Mib2. Whole-mount in situ hybridization using her4.1 (A) and xirp2a (B) antisense probe at 24 hpf. Maternal deletion of mib2 does not affect expression of her4.1 or xipr2a. Whole embryo (A) and trunk region (B) are shown. Arrows show expression of her4 in the trunk neural tube. Side views of embryos with anterior to the left.

Mib2 is not involved in melanophore development and does not antagonize Mib1ta52b protein

A loss of Mib1 function results in a white tail phenotype caused by a decrease in neural crest-derived black melanophores. As reported earlier, we observed the white tail phenotype in the mib1 mutants 2 days post fertilization (dpf), and the phenotype was more severe in mib1ta52b than in mib1tfi91 embryos (Fig. 5A,B) (mib1tfi91, 100% with mild phenotype, n=7; mib1ta52b, 100% with severe phenotype, n=10). In contrast, the tail pigmentation was normal in mib2cd3 mutant embryos, and the pigment phenotype was not enhanced in mib1tfi91; mib2cd3 double mutant embryos (Fig. 5A,B) (mib2cd3, 100% with normal phenotype, n=18: mib1tfi91; mib2cd3, 100% with similar phenotype to mib1tfi91, n=11).

Fig. 5.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 5.

Mib2 neither regulates melanophore development nor antagonizes Mib1ta52b protein. Whole embryos (A) or enlarged views (B) of tail region in A. mib2 deletion did not enhance pigmentation loss in mib1tfi91, nor did it recover pigmentation in mib1ta52b mutants. All panels show side views of embryos with anterior to the left.

Zhang et al. reported the dominant-negative effects of Mib1ta52b (M1013R) protein on Mib1 and Mib2 proteins. Specifically, they observed that a mib1-MO injection rescues mib1ta52b mutants to a mib1tfi91-like phenotype, and mib2-MO-injected mib1tfi91 mutants phenocopy mib1ta52b mutants. We observed a reduction of pigmentation in mib1ta52b mutants, which was rescued by mib1-MO injection (Fig. 5A,B) (control-MO injected mib1ta52b vs mib1-MO injected mib1ta52b, 100% rescued, n=7 and n=5, respectively). However, a loss of Mib2 did not recover pigmentation in mib1ta52b mutants (Fig. 5A,B) (mib1ta52b; mib2cd3, 100% not rescued, n=13). These results suggest that Mib2 does not play important roles in Notch signalling, which regulates pigment cell development. Furthermore, Mib2 does not influence the antimorphic effects of Mib1ta52b protein.

Notch-independent roles of Mib2 in muscle and NMDAR activity are not apparent in vivo

Mib2 is assumed to be involved in muscle integrity in zebrafish, as reported for Drosophila (Nguyen et al., 2007; Carrasco-Rando and Ruiz-Gomez, 2008). Therefore, we examined slow and fast muscle formation by detecting the levels of myoD mRNA and myosin heavy chain protein at 24 hpf. The level of myoD mRNA, which is expressed in both slow and fast muscles, was not dramatically changed in MZ mib2cd3 mutant embryos (Fig. 6A) (100% with normal expression, n=18). Likewise, slow muscle formation was not dramatically affected in mib2cd3 mutants, as detected by F59 antibody, which recognizes myosin heavy chain protein (Fig. 6B) (100% with normal expression, n=5).

Fig. 6.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 6.

Muscle structure is normal in mib2 mutant embryos. (A) Whole-mount in situ hybridization using the myoD in trunk region. (B) Slow muscle fibre myosin in trunk muscles as revealed by F59 antibody. mib2 mutant embryos did not show any changes in the pattern or level of their staining. All panels show side views of embryos with anterior to the left at 24 hpf.

Previously, Jurd et al. suggested that Mib2 negatively regulates the functional activity of NMDAR by ubiquitinating its NR2B subunit (Jurd et al., 2008). Unfortunately, we could not measure the NR2B protein level in the mib2cd3 mutant due to the unavailability of zebrafish NR2B-specific antibody. Therefore, we utilized an ammonia toxicity assay to evaluate NMDAR activity in zebrafish. Hyperammonaemia leads to elevated extracellular glutamate concentrations, which hyperstimulates NMDAR (Kosenko et al., 2003). Several NMDAR antagonists prevent hyperammonaemia-induced death in zebrafish (Feldman et al., 2014). As reported previously, we observed that ammonium acetate (NH4Ac) treatment significantly decreased survival compared with the control sodium acetate (NaAc) treatment (Fig. 7) (NaAC WT vs NH4Ac WT; P<0.001). However, NH4Ac treatment did not reduce the survival of mib2cd3 embryos compared with that of wild type control embryos (Fig. 7) (NH4Ac wt vs NH4Ac mib2cd3; P=0.61).

Fig. 7.
  • Download figure
  • Open in new tab
  • Download powerpoint
Fig. 7.

Mib2 deficiency does not affect survival of 4 dpf embryos exposed NH4Ac. Embryos were monitored for their heartbeats every 30 min. NaAc, sodium acetate-treated groups. NH4Ac, ammonium acetate-treated groups. The survival of mib2cd3 embryos was comparable to that of wild type control embryos by NH4Ac treatment. NaAC wild type, n=14; NH4Ac wild type, n=15. NaAC mib2cd3, n=7; NH4Ac mib2cd3, n=8.

These results suggested that Mib2 might not regulate muscle integrity and NMDAR activity in zebrafish during embryogenesis.

DISCUSSION

Mib2 does not play important roles in Notch signalling during development

Previous studies show that Mib2 ubiquitinates the Delta and Jagged proteins to enhance their endocytosis in vitro (Koo et al., 2005; Takeuchi et al., 2005). These actions are similar to that of Mib1, a paralogue of Mib2, which is known to be essential for activating Notch signalling in vivo. Here, we show that Mib2 is dispensable, at least during neurogenesis, somitogenesis, and pigment cell development, and for Notch signalling in zebrafish. Similar observations have been made in the mouse and Drosophila (Koo et al., 2007; Nguyen et al., 2007; Wu et al., 2007). Furthermore, our data suggest that the maternal gene product of Mib2 does not play a critical role during zebrafish development. These studies suggest that Mib2 is not essential for activating Notch signalling via the ubiquitination of Notch ligands during metazoan development, although we cannot exclude the possibility that Mib2 functions at later stages or in tissues that were not examined in this study.

Redundancy between Mib1 and Mib2 functions

Because Mib1 and Mib2 share substrates and form hetero-oligomers in vitro, they may act in a redundant fashion (Koo et al., 2005; Takeuchi et al., 2005; Zhang et al., 2007a). However, functional redundancy between Mib1 and Mib2 in vivo has been controversial in different species. Koo et al. reported that Mib1 and Mib2 do not act redundantly to control mouse embryonic development because a Mib1/Mib2 double knockout does not enhance the phenotypes of Mib1 knockout mice (Koo et al., 2007). In contrast, Zhang et al. suggested that these proteins play redundant roles based on the characterization of zebrafish antimorphic mib1 alleles (Zhang et al., 2007b).

In zebrafish, a phenotypic comparison of different mib1 alleles revealed that mibta52b (Mib1-M1013R) results in more severe defects than those of other alleles that produce a premature stop codon, such as mibtfi91 (Zhang et al., 2007b). Therefore, mibta52b is an antimorphic but not dominant-negative allele because it is inherited in a recessive manner. This recessive antimorphism is a rare genetic phenomenon and was recently reported for the strongest allele of the TSO1 gene in Arabidopsis (Sijacic et al., 2011). The recessive antimorphic allele can produce a phenotype more severe than null by interfering with the function of family genes. In accordance with this function, Zhang et al. suggested that Mib2 may be involved in the more pronounced phenotype in mib1ta52b, i.e. the roles of Mib2 and Mib1 are redundant, because mib1-null mutants (mibtfi91) with mib2 knockdown phenocopy mibta52b mutants and mib2 mRNA injection partially rescues mibta52b mutant phenotypes. On the contrary, our study showed that the genetic ablation of mib2 neither enhances mibtfi91 phenotypes nor alleviates mibta52b phenotypes, suggesting that the actions of endogenous Mib2 and Mib1 are not redundant.

Two possibilities may account for this discrepancy. First, the truncated Mib2 protein, which is produced by the mib2cd3 allele but not by the mib2-MO knockdown, might exert residual functions to support Mib1/Mib2 hetero-oligomer activity. However, this possibility is unlikely because the level truncated mib2cd3 protein itself may be reduced due to its mRNA decay. Second, other protein(s) may compensate for a loss of Mib2 function in the mib2cd3 allele during development, but this developmental compensation is precluded by morpholino-mediated mib2 knockdown. Supporting the this notion, Rossi et al. recently reported the activation of a compensatory network to buffer against genetic deleterious mutations, which was not observed after translational or transcriptional knockdown (Rossi et al., 2015). Future studies should investigate the compensatory activation of genes in mib2cd3 mutants.

Notch signalling-independent functions of Mib2

Several Notch-independent functions of Mib2 have been reported (Nguyen et al., 2007; Jurd et al., 2008; Stempin et al., 2011). In Drosophila, Mib2 plays a Notch-independent role in muscle integrity and survival (Nguyen et al., 2007; Carrasco-Rando and Ruiz-Gomez, 2008). However, our study and others show that in zebrafish, Mib1 but not Mib2 is sufficient for the maintenance of somite integrity (Pascoal et al., 2013). Therefore, the role of Mib family proteins in the muscular system may differ by species.

The NR2B subunit of the NMDAR is a potential substrate for Mib2 and is negatively regulated by Mib2 in a ubiquitin-proteasome-dependent manner in vitro (Jurd et al., 2008). In the absence of Mib2 function, NMDAR activity might be upregulated due to the increased NR2B protein level. However, Mib2 deficiency does not affect NMDAR activity in zebrafish embryos, as assessed based on the neurotoxic effects of ammonia, suggesting that Mib2 may not be involved in NMDAR activity. However, one caveat associated with this interpretation is that the ammonia toxicity assay is not sufficiently sensitive to determine the effect of Mib2 on NMDAR activity in vivo. Future studies should address this issue.

MATERIAL AND METHOD

Zebrafish lines and maintenance

The zebrafish were raised and maintained under standard conditions with approval by the Institutional Animal Care and Use Committee at Chiba University. Zebrafish embryos were obtained from the natural spawning of wild-type adults or identified carriers, which were heterozygous for mib2cd1, mib2cd3, mib1tfi91; mib2cd3, mib1ta52b; mib2cd3, and mib1tfi91 and homozygous for mib2cd3.

Construction of TALEN plasmids

The plasmids used to synthesize TALEN mRNAs were constructed as described previously (Hisano et al., 2015). RVD repeat arrays were cloned into pCS2TAL3DD and pCS2TAL3RR to generate left and right TALEN constructs (mib2-TALEN-F and mib2-TALEN-R). The amino acid sequences of the constructed TALENs are shown in Table S1.

mRNA and morpholino antisense oligonucleotide injection

To microinject TALEN mRNA, the mib2-TALEN-F and mib2-TALEN-R plasmid were linearized and transcribed with SP6 RNA polymerase using the mMessage mMachine Kit (Life Technologies). The mib2 forward and reverse TALEN mRNAs (400 pg each) were injected together into the blastomeres of zebrafish embryos at the one-cell stage. The Mib1 morpholino was obtained from Gene Tools and used as described previously (Itoh et al., 2003).

Whole-mount in situ hybridization and antibody staining

Whole-mount in situ hybridization was performed as described previously (Yamamoto et al., 2010). The zebrafish mib2 probe was generated from a pCR TOPOII vector plasmid in which the mib2 cDNA fragment was subcloned. All probes have been previously published: her4.1 (Takke et al., 1999), elavl3 (Kim et al., 1996), xirp2a (Schröter and Oates, 2010). Whole-mount antibody staining was performed using the following antibodies: anti-Myosin heavy chain (F59, DSHB) and Alexa-488 anti-mouse IgG (Invitrogen).

PCR-based restriction fragment length polymorphism typing

Genotyping was performed using following primers and restriction enzymes. Fragments were confirmed by electrophoresis.

cd1: Fw, CTGCTACAGGCTAACAGTAATAT and Rev, ATAACGATTTCTGCAGCGAAG. Restriction enzyme, SspI (TAKARA BIO, Japan). Fragment size: wild type, 130 bp; heterozygote, 150+130 bp; homozygote, 150 bp. cd3: Fw, GGTGGACATTAAGAACCAGGGAAAG and Rev, GCGCCGCGTCTCCGTCCTCATCTTAAGCT. Restriction enzyme, HindIII (TOYOBO, Japan). Fragment size: wild type, 100 bp; heterozygote, 130 bp+100 bp; homozygote; 130 bp.

Quantitative RT–PCR (q-PCR)

Total RNA was obtained using RNAiso Plus (TaKaRa Bio, Japan) according to the manufacturer's protocol. Total RNA was reverse transcribed using ReverTra Ace (TOYOBO) according to the manufacturer's protocol. The zebrafish mib2 gene sequence was retrieved from the UCSC Genome Browser for real time PCR (http://genome.ucsc.edu/cgi-bin/hgGateway). The primers were designed by Primer3web version 4.0.0 (http://primer3.ut.ee/). Primer specificity was confirmed by NCBI/Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). The transcript levels of mib2 and Rpl13α were quantified by real-time PCR with Power SYBR Mix (Applied Biosystems) on a 7300 Real-Time PCR detection system (Applied Biosystems) as described previously (Itoh et al., 2014).

Ammonia toxicity assay

One dpf embryos were arrayed in a 12-well plate with 3 ml of E3 medium (5 mM NaCl, 0.17 mM KCl, 0.33 mM CaCl2, and 0.33 mM MgSO4). At 4 dpf, the larvae were treated with sodium acetate (NaAc; Wako, Japan) or ammonium acetate (NH4Ac; Wako). The survival time was assessed every 30 min based on the presence/absence of a visible heartbeat. The Mantel–Cox log-rank test was used to statistically analyse the data using the Prism 6 software (GraphPad).

Acknowledgements

We thank T. Yabe (Okazaki Institute for Integrative Bioscience and National Institute for Basic Biology, Japan) for the xirp2a plasmid, Y. J. Jiang (Institute of Molecular and Genomic Medicine, Taiwan) for mib1tfi91, the Zebrafish National BioResource Project of Japan for providing zebrafish strains, and H. Matsuo, Y. Akatsu, and N. Fujiwara for their technical assistance.

Footnotes

  • Competing interests

    The authors declare no competing or financial interests.

  • Author contributions

    S.M. and M.I. conceived and designed the experiments, S.M., M.N., A.K. and T.M. performed the experiments, S.M., T.M. and M.I. analysed the data and wrote the paper.

  • Funding

    This research was supported in part by a Grant for Basic Science Research Projects from the Sumitomo Foundation [Grant No. 11061] to M.I., Grants-in-Aid for Scientific Research Programs in Japan [Grant Nos. 24370080 and 25117705] from MEXT to M.I, and a Grant-in-Aid for Scientific Research on Innovative Areas (Brain Protein Ageing and Dementia Control) [15H01551] from MEXT to M.I.

  • Supplementary information

    Supplementary information available online at http://bio.biologists.org/lookup/suppl/doi:10.1242/bio.014225/-/DC1

  • Received August 22, 2015.
  • Accepted October 5, 2015.
  • © 2015. Published by The Company of Biologists Ltd

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/3.0), which permits unrestricted use, distribution and reproduction in any medium provided that the original work is properly attributed.

References

  1. ↵
    1. Carrasco-Rando, M. and
    2. Ruiz-Gomez, M.
    (2008). Mind bomb 2, a founder myoblast-specific protein, regulates myoblast fusion and muscle stability. Development 135, 849-857. doi:10.1242/dev.015529
    OpenUrlAbstract/FREE Full Text
  2. ↵
    1. Feldman, B.,
    2. Tuchman, M. and
    3. Caldovic, L.
    (2014). A zebrafish model of hyperammonemia. Mol. Genet. Metab. 113, 142-147. doi:10.1016/j.ymgme.2014.07.001
    OpenUrlCrossRefPubMed
  3. ↵
    1. Gritsman, K.,
    2. Zhang, J.,
    3. Cheng, S.,
    4. Heckscher, E.,
    5. Talbot, W. S. and
    6. Schier, A. F.
    (1999). The EGF-CFC protein one-eyed pinhead is essential for nodal signaling. Cell 97, 121-132. doi:10.1016/S0092-8674(00)80720-5
    OpenUrlCrossRefPubMedWeb of Science
  4. ↵
    1. Guruharsha, K. G.,
    2. Kankel, M. W. and
    3. Artavanis-Tsakonas, S.
    (2012). The Notch signalling system: recent insights into the complexity of a conserved pathway. Nat. Rev. Genet. 13, 654-666. doi:10.1038/nrg3272
    OpenUrlCrossRefPubMed
  5. ↵
    1. Hisano, Y.,
    2. Inoue, A.,
    3. Okudaira, M.,
    4. Taimatsu, K.,
    5. Matsumoto, H.,
    6. Kotani, H.,
    7. Ohga, R.,
    8. Aoki, J. and
    9. Kawahara, A.
    (2015). Maternal and zygotic sphingosine kinase 2 are indispensable for cardiac development in zebrafish. J. Biol. Chem. 290, 14841-14851. doi:10.1074/jbc.M114.634717
    OpenUrlAbstract/FREE Full Text
  6. ↵
    1. Itoh, M.,
    2. Kim, C.-H.,
    3. Palardy, G.,
    4. Oda, T.,
    5. Jiang, Y.-J.,
    6. Maust, D.,
    7. Yeo, S.-Y.,
    8. Lorick, K.,
    9. Wright, G. J.,
    10. Ariza-McNaughton, L. et al.
    (2003). Mind bomb is a ubiquitin ligase that is essential for efficient activation of Notch signaling by Delta. Dev. Cell 4, 67-82. doi:10.1016/S1534-5807(02)00409-4
    OpenUrlCrossRefPubMedWeb of Science
  7. ↵
    1. Itoh, M.,
    2. Nakaura, M.,
    3. Imanishi, T. and
    4. Obika, S.
    (2014). Target gene knockdown by 2′,4′-BNA/LNA antisense oligonucleotides in zebrafish. Nucleic Acid Ther. 24, 186-191. doi:10.1089/nat.2013.0464
    OpenUrlCrossRefPubMed
  8. ↵
    1. Jurd, R.,
    2. Thornton, C.,
    3. Wang, J.,
    4. Luong, K.,
    5. Phamluong, K.,
    6. Kharazia, V.,
    7. Gibb, S. L. and
    8. Ron, D.
    (2008). Mind bomb-2 is an E3 ligase that ubiquitinates the N-methyl-D-aspartate receptor NR2B subunit in a phosphorylation-dependent manner. J. Biol. Chem. 283, 301-310. doi:10.1074/jbc.M705580200
    OpenUrlAbstract/FREE Full Text
  9. ↵
    1. Kim, C.-H.,
    2. Ueshima, E.,
    3. Muraoka, O.,
    4. Tanaka, H.,
    5. Yeo, S.-Y.,
    6. Huh, T.-L. and
    7. Miki, N.
    (1996). Zebrafish elav/HuC homologue as a very early neuronal marker. Neurosci. Lett. 216, 109-112. doi:10.1016/0304-3940(96)13021-4
    OpenUrlCrossRefPubMedWeb of Science
  10. ↵
    1. Kok, F. O.,
    2. Shin, M.,
    3. Ni, C.-W.,
    4. Gupta, A.,
    5. Grosse, A. S.,
    6. van Impel, A.,
    7. Kirchmaier, B. C.,
    8. Peterson-Maduro, J.,
    9. Kourkoulis, G.,
    10. Male, I. et al.
    (2015). Reverse genetic screening reveals poor correlation between morpholino-induced and mutant phenotypes in zebrafish. Dev. Cell 32, 97-108. doi:10.1016/j.devcel.2014.11.018
    OpenUrlCrossRefPubMed
  11. ↵
    1. Komander, D. and
    2. Rape, M.
    (2012). The ubiquitin code. Annu. Rev. Biochem. 81, 203-229. doi:10.1146/annurev-biochem-060310-170328
    OpenUrlCrossRefPubMedWeb of Science
  12. ↵
    1. Koo, B.-K.,
    2. Yoon, K.-J.,
    3. Yoo, K.-W.,
    4. Lim, H.-S.,
    5. Song, R.,
    6. So, J.-H.,
    7. Kim, C.-H. and
    8. Kong, Y.-Y.
    (2005). Mind bomb-2 is an E3 ligase for Notch ligand. J. Biol. Chem. 280, 22335-22342. doi:10.1074/jbc.M501631200
    OpenUrlAbstract/FREE Full Text
  13. ↵
    1. Koo, B.-K.,
    2. Yoon, M.-J.,
    3. Yoon, K.-J.,
    4. Im, S.-K.,
    5. Kim, Y.-Y.,
    6. Kim, C.-H.,
    7. Suh, P.-G.,
    8. Jan, Y. N. and
    9. Kong, Y.-Y.
    (2007). An obligatory role of mind bomb-1 in notch signaling of mammalian development. PLoS ONE 2, e1221. doi:10.1371/journal.pone.0001221
    OpenUrlCrossRefPubMed
  14. ↵
    1. Kosenko, E.,
    2. Venediktova, N.,
    3. Kaminsky, Y.,
    4. Montoliu, C. and
    5. Felipo, V.
    (2003). Sources of oxygen radicals in brain in acute ammonia intoxication in vivo. Brain Res. 981, 193-200. doi:10.1016/S0006-8993(03)03035-X
    OpenUrlCrossRefPubMedWeb of Science
  15. ↵
    1. Metzger, M. B.,
    2. Pruneda, J. N.,
    3. Klevit, R. E. and
    4. Weissman, A. M.
    (2014). RING-type E3 ligases: master manipulators of E2 ubiquitin-conjugating enzymes and ubiquitination. Biochim. Biophys. Acta 1843, 47-60. doi:10.1016/j.bbamcr.2013.05.026
    OpenUrlCrossRef
  16. ↵
    1. Mintzer, K. A.,
    2. Lee, M. A.,
    3. Runke, G.,
    4. Trout, J.,
    5. Whitman, M. and
    6. Mullins, M. C.
    (2001). Lost-a-fin encodes a type I BMP receptor, Alk8, acting maternally and zygotically in dorsoventral pattern formation. Development 128, 859-869.
    OpenUrlAbstract
  17. ↵
    1. Nguyen, H. T.,
    2. Voza, F.,
    3. Ezzeddine, N. and
    4. Frasch, M.
    (2007). Drosophila mind bomb2 is required for maintaining muscle integrity and survival. J. Cell Biol. 179, 219-227. doi:10.1083/jcb.200708135
    OpenUrlAbstract/FREE Full Text
  18. ↵
    1. Pascoal, S.,
    2. Esteves de Lima, J.,
    3. Leslie, J. D.,
    4. Hughes, S. M. and
    5. Saúde, L.
    (2013). Notch signalling is required for the formation of structurally stable muscle fibres in zebrafish. PLoS ONE 8, e68021. doi:10.1371/journal.pone.0068021
    OpenUrlCrossRefPubMed
  19. ↵
    1. Pickart, C. M.
    (2001). Mechanisms underlying ubiquitination. Annu. Rev. Biochem. 70, 503-533. doi:10.1146/annurev.biochem.70.1.503
    OpenUrlCrossRefPubMedWeb of Science
  20. ↵
    1. Popovic, D.,
    2. Vucic, D. and
    3. Dikic, I.
    (2014). Ubiquitination in disease pathogenesis and treatment. Nat. Med. 20, 1242-1253. doi:10.1038/nm.3739
    OpenUrlCrossRefPubMed
  21. ↵
    1. Rossi, A.,
    2. Kontarakis, Z.,
    3. Gerri, C.,
    4. Nolte, H.,
    5. Hölper, S.,
    6. Krüger, M. and
    7. Stainier, D. Y. R.
    (2015). Genetic compensation induced by deleterious mutations but not gene knockdowns. Nature 524, 230-233. doi:10.1038/nature14580
    OpenUrlCrossRefPubMed
  22. ↵
    1. Schröter, C. and
    2. Oates, A. C.
    (2010). Segment number and axial identity in a segmentation clock period mutant. Curr. Biol. 20, 1254-1258. doi:10.1016/j.cub.2010.05.071
    OpenUrlCrossRefPubMed
  23. ↵
    1. Sijacic, P.,
    2. Wang, W. and
    3. Liu, Z.
    (2011). Recessive antimorphic alleles overcome functionally redundant loci to reveal TSO1 function in Arabidopsis flowers and meristems. PLoS Genet. 7, e1002352. doi:10.1371/journal.pgen.1002352
    OpenUrlCrossRefPubMed
  24. ↵
    1. Stempin, C. C.,
    2. Chi, L.,
    3. Giraldo-Vela, J. P.,
    4. High, A. A.,
    5. Hacker, H. and
    6. Redecke, V.
    (2011). The E3 ubiquitin ligase mind bomb-2 (MIB2) protein controls B-cell CLL/lymphoma 10 (BCL10)-dependent NF-kappaB activation. J. Biol. Chem. 286, 37147-37157. doi:10.1074/jbc.M111.263384
    OpenUrlAbstract/FREE Full Text
  25. ↵
    1. Takeuchi, T.,
    2. Heng, H. H. Q.,
    3. Ye, C. J.,
    4. Liang, S.-B.,
    5. Iwata, J.,
    6. Sonobe, H. and
    7. Ohtsuki, Y.
    (2003). Down-regulation of a novel actin-binding molecule, skeletrophin, in malignant melanoma. Am. J. Pathol. 163, 1395-1404. doi:10.1016/S0002-9440(10)63497-9
    OpenUrlCrossRefPubMedWeb of Science
  26. ↵
    1. Takeuchi, T.,
    2. Adachi, Y. and
    3. Ohtsuki, Y.
    (2005). Skeletrophin, a novel ubiquitin ligase to the intracellular region of Jagged-2, is aberrantly expressed in multiple myeloma. Am. J. Pathol. 166, 1817-1826. doi:10.1016/S0002-9440(10)62491-1
    OpenUrlCrossRefPubMed
  27. ↵
    1. Takke, C.,
    2. Dornseifer, P.,
    3. v Weizsacker, E. and
    4. Campos-Ortega, J. A.
    (1999). her4, a zebrafish homologue of the Drosophila neurogenic gene E(spl), is a target of NOTCH signalling. Development 126, 1811-1821.
    OpenUrlAbstract/FREE Full Text
  28. ↵
    1. Tseng, L.-C.,
    2. Zhang, C.,
    3. Cheng, C.-M.,
    4. Xu, H.,
    5. Hsu, C.-H. and
    6. Jiang, Y.-J.
    (2014). New classes of mind bomb-interacting proteins identified from yeast two-hybrid screens. PLoS ONE 9, e93394. doi:10.1371/journal.pone.0093394
    OpenUrlCrossRefPubMed
  29. ↵
    1. Wu, J. I.,
    2. Rajendra, R.,
    3. Barsi, J. C.,
    4. Durfee, L.,
    5. Benito, E.,
    6. Gao, G.,
    7. Kuruvilla, M.,
    8. Hrdličková, R.,
    9. Liss, A. S. and
    10. Artzt, K.
    (2007). Targeted disruption of Mib2 causes exencephaly with a variable penetrance. Genesis 45, 722-727. doi:10.1002/dvg.20349
    OpenUrlCrossRefPubMedWeb of Science
  30. ↵
    1. Yamamoto, M.,
    2. Morita, R.,
    3. Mizoguchi, T.,
    4. Matsuo, H.,
    5. Isoda, M.,
    6. Ishitani, T.,
    7. Chitnis, A. B.,
    8. Matsumoto, K.,
    9. Crump, J. G.,
    10. Hozumi, K. et al.
    (2010). Mib-Jag1-Notch signalling regulates patterning and structural roles of the notochord by controlling cell-fate decisions. Development 137, 2527-2537. doi:10.1242/dev.051011
    OpenUrlAbstract/FREE Full Text
  31. ↵
    1. Zhang, C.,
    2. Li, Q. and
    3. Jiang, Y.-J.
    (2007a). Zebrafish Mib and Mib2 are mutual E3 ubiquitin ligases with common and specific delta substrates. J. Mol. Biol. 366, 1115-1128. doi:10.1016/j.jmb.2006.11.096
    OpenUrlCrossRefPubMedWeb of Science
  32. ↵
    1. Zhang, C.,
    2. Li, Q.,
    3. Lim, C.-H.,
    4. Qiu, X. and
    5. Jiang, Y.-J.
    (2007b). The characterization of zebrafish antimorphic mib alleles reveals that Mib and Mind bomb-2 (Mib2) function redundantly. Dev. Biol. 305, 14-27. doi:10.1016/j.ydbio.2007.01.034
    OpenUrlCrossRefPubMedWeb of Science
Previous ArticleNext Article
Back to top
Previous ArticleNext Article

This Issue

RSSRSS

Keywords

  • Mib2
  • Notch signalling
  • Neuronal development
  • Zebrafish
  • Ubiquitin ligase

 Download PDF

Email

Thank you for your interest in spreading the word on Biology Open.

NOTE: We only request your email address so that the person you are recommending the page to knows that you wanted them to see it, and that it is not junk mail. We do not capture any email address.

Enter multiple addresses on separate lines or separate them with commas.
Mindbomb 2 is dispensable for embryonic development and Notch signalling in zebrafish
(Your Name) has sent you a message from Biology Open
(Your Name) thought you would like to see the Biology Open web site.
CAPTCHA
This question is for testing whether or not you are a human visitor and to prevent automated spam submissions.
Share
Research Article
Mindbomb 2 is dispensable for embryonic development and Notch signalling in zebrafish
Shohei Mikami, Mizuki Nakaura, Atsuo Kawahara, Takamasa Mizoguchi, Motoyuki Itoh
Biology Open 2015 4: 1576-1582; doi: 10.1242/bio.014225
del.icio.us logo Digg logo Reddit logo Twitter logo CiteULike logo Facebook logo Google logo Mendeley logo
Citation Tools
Research Article
Mindbomb 2 is dispensable for embryonic development and Notch signalling in zebrafish
Shohei Mikami, Mizuki Nakaura, Atsuo Kawahara, Takamasa Mizoguchi, Motoyuki Itoh
Biology Open 2015 4: 1576-1582; doi: 10.1242/bio.014225

Citation Manager Formats

  • BibTeX
  • Bookends
  • EasyBib
  • EndNote (tagged)
  • EndNote 8 (xml)
  • Medlars
  • Mendeley
  • Papers
  • RefWorks Tagged
  • Ref Manager
  • RIS
  • Zotero
Alerts

Please log in to add an alert for this article.

Sign in to email alerts with your email address

Article Navigation

  • Top
  • Article
    • ABSTRACT
    • INTRODUCTION
    • RESULTS
    • DISCUSSION
    • MATERIAL AND METHOD
    • Acknowledgements
    • Footnotes
    • References
  • Figures & tables
  • Supp info
  • Info & metrics
  • eLetters
  • PDF + SI
  • PDF

Related articles

Cited by...

More in this TOC section

  • Stability of amino acids and related amines in human serum under different preprocessing and pre-storage conditions based on iTRAQ®-LC-MS/MS
  • Tetraspanin18 regulates angiogenesis through VEGFR2 and Notch pathways
  • Segregation of brain and organizer precursors is differentially regulated by Nodal signaling at blastula stage
Show more RESEARCH ARTICLE

Similar articles

Other journals from The Company of Biologists

Development

Journal of Cell Science

Journal of Experimental Biology

Disease Models & Mechanisms

Advertisement

Biology Open and COVID-19

We are aware that the COVID-19 pandemic is having an unprecedented impact on researchers worldwide. The Editors of all The Company of Biologists’ journals have been considering ways in which we can alleviate concerns that members of our community may have around publishing activities during this time. Read about the actions we are taking at this time.

Please don’t hesitate to contact the Editorial Office if you have any questions or concerns.


New funding scheme supports sustainable events

As part of our Sustainable Conferencing Initiative, we are pleased to announce funding for organisers that seek to reduce the environmental footprint of their event. The next deadline to apply for a Scientific Meeting grant is 26 March 2021.


Future Leader Review – early neurodegeneration of Alzheimer’s disease

A new Future Leader Review from Olayemi Olajide, Marcus Suvanto and Clifton Andrew Chapman evaluates the molecular mechanisms that may explain the vulnerability and susceptibility of the entorhinal cortex to early neurodegeneration during the pathogenesis of Alzheimer's disease.

Find out more about our Future Leader Reviews – they are an exclusive opportunity for early-career researchers who want to establish themselves in their field.


First author interviews

Catch up on our latest first author interviews to go behind the scenes of our latest research, find out more about the authors and hear from early-career researchers themselves how they’re finding life at the bench.


Retinal degeneration in Drosophila

Thank you to Elisabeth Knust and her team for their confocal image of a longitudinal section of an adult Drosophila retina, which brightens the cover of our latest issue. Read the research behind the cover.

Articles

  • Accepted manuscripts
  • Issue in progress
  • Latest complete issue
  • Issue archive
  • Archive by article type
  • Interviews
  • Sign up for alerts

About us

  • About BiO
  • Editors and Board
  • Editor biographies
  • Grants and funding
  • Journal Meetings
  • Workshops
  • The Company of Biologists

For Authors

  • Submit a manuscript
  • Aims and scope
  • Presubmission enquiries
  • Article types
  • Manuscript preparation
  • Cover suggestions
  • Editorial process
  • Promoting your paper
  • Open Access

Journal Info

  • Journal policies
  • Rights and permissions
  • Media policies
  • Reviewer guide
  • Sign up for alerts

Contact

  • Contact BiO
  • Advertising
  • Feedback

Twitter   YouTube   LinkedIn

© 2021   The Company of Biologists Ltd   Registered Charity 277992